Immunoprecipitation Kits
Catch and Release v2.0
Catch and Release Reversible Immunoprecipitation System
Catch and Release Reversible Immunoprecipiation System (Cat.No 17-500) overcomes many of the limitations associated with conventional IP. Its unique Spin-Column format was designed to make IP faster, simpler and more reproducible. Catch and Release enables the elution of the antigen:antibody complex without denaturation, while ensuring minimal contamination by non-specific proteins in the eluate. In addition, the convenient Spin-Column format of Catch and Release improves performance and makes higher throughput processing of samples possible.
Catch and Release Columns contain a proprietary resin in a microfuge-compatible Spin Column secured by a screw cap top and a break away closure on the bottom. An Antibody Capture Affinity Ligand, for binding the antigen:antibody complex, is also provided and serves as a tether between the complex and the resin. Most lysate proteins and antibodies will exhibit little or no binding to the resin without the Antibody Capture Affinity Ligand. It is this feature that enables the fast and simple elution of the antigen:antibody complex from the resin in either a denatured or native form. Catch and Release® has been successfully tested on a number of proteins with both rabbit and mouse antibodies. As little as 30 minutes of incubation with most antibodies can provide the desired results, demonstrating a significant time advantage to researchers as compared with conventional IP methods.
Catch and Release Advantages
- Convenient – IP without the need for Protein A or G agarose
- Reversible – elute protein in either native or denatured form
- Reproducible – novel spin column format dramatically simplifies sample handing and ensures assay reproducibility
System Components
- Antibody Capture Affinity Ligand: One vial containing 60 μg Antibody Capture Affinity Ligand in 500 μl PBS containing 10% glycerol and 2 mM PMSF. Store at 4°C. Stable for 6 months.
- Catch and Release® Wash Buffer, 10X: One vial containing 15 ml of 10X buffer, pH 7.4 containing the following detergents: 10% NP-40 and 2. 5% deoxycholic acid. Liquid at 4°C. Stable for two years.Note: If crystallization occurs when buffer is stored at 4°C, warm to room temperature and vortex briefly before use.
- Catch and Release Spin Columns: 50 columns containing 0.5 ml (20% w/v) of IP capture resin in suspension.
- Catch and Release Capture Tubes: 100 reservoir tubes.
*The Catch and Release® Sample Pack (cat. #17-500A) contains 1/10 the amount of reagents supplied in the regular pack size (cat. #17-500)
Preparing Reagents
- Unless otherwise noted, all dilutions of stock reagents provided in the kit are to be done with high-quality water, such as Milli-Q® water.
- If gel electrophoresis is to be performed, it should be done according to the specifications set by the manufacturers of the gel and the apparatus, taking into consideration the specific protein(s) that need to be resolved.
- When transferring the resolved proteins to a membrane, follow the recommendations set by the manufacturer of the transfer apparatus.
- IP with Catch and Release and subsequent Western blot analysis is compatible with either nitrocellulose or PVDF membranes.
Catch and Release Protocol
Note: The Catch and Release procedure as outlined below uses incubation times and temperatures that have been demonstrated to work well with antibodies to many different target proteins. If these conditions differ from the conditions used in your conventional IP procedure, you should follow your conventional method in your first use of the kit. For example, if you normally incubate a sample with your primary antibody for 1 hour at 4°C, then you should do the same in Step 5. Once you have verified that Catch and Release kit works with your antibody and protein, you may choose to optimize the procedure by adjusting incubation times. Some antibodies will exhibit optimal antigen binding in as little as 10–15 minutes, others may require an overnight incubation; some incubations will work at room temperature, while others are best performed at 4°C. These two key parameters should be empirically determined by the researcher for every antibody, lysate and protein of interest.
Note: Catch and Release kit should not be used to IP His-tagged proteins</p>
- Dilute enough 10X Catch and Release Wash Buffer to the 1X working concentration with Milli-Q® water for incubation and all washes. You will need approximately 2.5 ml for washes and some additional volume possibly for the antibody incubation (Step 4).
- Label the Spin Columns, Capture Tubes and micro- centrifuge tubes to be used. Remove the snap-off bottom plug (save for later use; see the figure on the following page), and insert the Spin Column into a Capture Tube. Remove the screw-on cap and centrifuge at 5000 rpm (2000 xg) for 15–30 seconds to remove the resin slurry buffer. Wash the resin twice with 400 μl 1X Wash Buffer. Empty the Capture Tube, and plug the bottom end of the Column with the snap-off bottom plug.
- Determine the volume of combined reagents:
- 500 μg of cell lysate. Note: 1. This is a recommended starting amount, but the optimal amount may need to be empirically determined for each individual antibody and antigen. 2. High concentrations (>1 mM) of reducing agents, such as dithiothreitol (DTT) or ß-mercaptoethanol (ßME), may denature antigens or antibodies and prevent capture.
- 1–4 μg of a specific primary antibody and negative control antibody. 5–10 μl of whole antiserum or ascites fluid. Note: These are recommended starting amounts but the optimal amounts may need to be empirically determined for each individual antibody and sample containing antigen. It is highly recommended to perform corresponding negative IP controls (for any immunoprecipitation procedure) as side-by-side comparison.
- 10 μl of Antibody Capture Affinity Ligand
- Sufficient 1X Wash Buffer to provide a final total volume of 500 μl
- With the bottom end of the Spin Column plugged, add the reagents in the following order to the column:
- 1X Wash Buffer
- Cell lysate
- Specific primary antibody or negative control antibody
- Antibody Capture Affinity Ligand
- Cap the top of the Column (using the screw-on cap), and incubate on a rotator or mixer at room temperature for 30 minutes ensuring that the slurry remains suspended during incubation.
- Remove the snap-off bottom plug and discard. Place the Column in the Capture tube. Remove the screw-on cap and centrifuge at 5000 rpm (2000 xg) for 15–30 seconds to collect flow-through. Transfer the flow-through to a microcentrifuge tube and save for Western blot analysis, if desired (it may be useful for trouble-shooting, if necessary).
- Wash the Column 3X with 400 μl of 1X Wash Buffer, spinning at 5000 rpm (2000 xg) 15–30 seconds for each wash. Washes may be saved (if desired) for Western blot analysis and trouble-shooting.
- Place the Column into a fresh Capture Tube.
- Proteins may be eluted from the Column in either a denatured form (i.e. for SDS-PAGE and Western blotting), or a native form (for Kinase Assays), following 9A or 9B.
- For elution of protein in its denatured, reduced form: Add 70 μl of 1X Denaturing Elution Buffer containing ßME to the Spin Column. Centrifuge and save eluate for Western analysis. Note: This can be done as an additional step after Step 9B.
- For elution of protein in its native form: Dilute 4X Non-Denaturing Elution Buffer to 1X, and add 70 μl to the Spin Column. Centrifuge the Spin Column at 5000 rpm (2000 xg), and save the eluate for Western analysis or other assays.
- Notes:
- Additional elutions with 2X or 4X Non-Denaturing Elution Buffer can be done for maximum recovery of bound material.
- Successive elutions using either or both protocols (Steps 9A and/or 9B) may allow a more complete recovery of the antigen.
Catch and Release Kit System Data vs. Conventional Immunoprecipitation Data
Catch and Release Kit with Non-Denaturing Elution |
Catch and Release Kit with Denaturing Elution |
Conventional IP with Denaturing Elution |
Catch and Release Immunoprecipitation Kinase Assay (IPK) Protocol
To perform a kinase assay using the eluted protein in its native form (i.e., non-denaturing elution listed in Step 9B above.), the Catch and Release kit was used with Anti-Erk1/2 (cat. #06-182) which immunoprecipates active Erk1/2. Active Erk1/2 was eluted and used in conjunction with Millipore’s non-radioactive MAP Kinase/Erk Assay Kit (cat. #17-191). The non-radioactive MAP Kinase/Erk assay kit is designed to measure the phosphotransferase activity of MAP (mitogen-activated protein) Kinase (also known as Erk1/2) in immunoprecipitates. The assay kit is based on phosphorylation of a specific substrate (myelin basic protein, MBP). The phosphorylated substrate is then analyzed by immunoblot analysis, probing with a monoclonal Phospho-specific MBP antibody.
Cell Lysate Preparation
Rat Pheochromocytoma (PC-12) cells grown to sub-confluence and serum starved overnight. To activate Map Kinase, the cells were stimulated with NGF (50 ng/ml for 10 minutes at 37°C) and were lysed in ice cold buffer A (50 mM Tris, pH 7.5, 1 mM EDTA, 1 mM EGTA, 0.5mM Na3VO4, 0.1% ß-mercaptoethanol, 1% Triton X-100, 50 mM sodium fluoride, 5mM sodium pyrophosphate, 10 mM sodium ß-glycerol phosphate, 0.1 mM PMSF, 1 mg/ml of aprotinin, pepstatin, leupeptin and 1 mM Microcystin). Microcystin was added to ensure complete inactivation of cellular PP1 and PP2A phosphatases, which may dephosphorylate the active MAP Kinase.
Any insoluble material after cell lysis was pelleted by centrifugation at 16,000 xg for 10 minutes at 4°C. A Bradford assay, using BSA as a standard, was used to assess total protein concentration of the cell lysate. The cell lysate was diluted to 1 mg/ml with ice cold buffer A prior to performing the immunoprecipitation to maintain kinase activity.
Catch and Release Kit with Non-Denaturing Elution to Immunoprecipitate Active Kinase | Immunoprecipitation Kinase Assay was performed using NGF-treated P12 cells lysed with Buffer A (see Certificate of Analysis for Cat. #06-182. Lysate (500 µg) was used for IP with 4 µg of either normal Rabbit lgG (lanes 1 and 3) or Anti-MAP Kinase (lanes 2 and 4.) IP was performed with Catch and Release (lanes 1 and 2) or by conventional IP (lanes 3 and 4). Catch and Release kit was used as described in the instruction manual, except that the final wash used Assay Dilution Buffer (included in Cat. #17-191), and the eluate was diluted 1X with Assay Dilution Buffer. Following IP, equivalent amounts of Catch and Release eluate or agarose beads from the conventional IP were used for MAP Kinase assay using a non-radioactive MAP Kinase Assay Kit, which utilizes the MBP as a substrate for MAP Kinase. Note: lgG heavy chain is not detected because IP antibody was rabbit lgG, and Western detection used mouse monoclonal antibody. After the assay, reactions were stopped with SDS-PAGE sample buffer and used for SDS-PAGE/Western blotting analysis using anti-phospho-MBP. The migration position of phosphorylated MBP is indicated by an arrow (the larger molecular weight proteins detected may be chimerized and/or unreduced phosphorylated MBP)/ It can be seen that immunoprecipitation using the Catch and Release system, effectively immunoprecipitated active MAP Kinase. Interestingly, kinase obtained using Catch and Release kit appeared to be significantly more active than kinase used from conventional IP, which was still in complex with agarose beads. |
Protocol to Immunoprecipitate Active Kinase
4 μg of negative normal rabbit IgG or 4 μg of anti-Erk1/2 was used as described in the Catch and Release Reversible Immunoprecipitation protocol above; except that at step 7 the final column wash was performed with Kinase Assay Dilution Buffer (ADB) included in non-radioactive MAP Kinase/Erk assay kit (cat. #17-191), and the eluate was diluted 1X (i.e., the 70 μl eluate in step 9B was diluted equally with ADB).
All kinase reactions were performed using either normal IgG (negative control) or anti-Erk1/2 and were performed in a total volume of 50 μl. Reactions were at 30°C for 30 minutes with mixing:
| Component | Amount |
| MAP Kinase Substrate Cocktail (cat. #20-166) | 10 μL |
| Magnesium/ATP Cocktail (cat. #20-113) | 10 μL |
| Assay Dilution Buffer (cat. #20-108) | 10 μL |
| Eluate of IP material | 20 μL |
| Total | 50 μL |
After incubation, 50 μl kinase reactions were diluted in 2X Laemmli sample buffer/reducing sample buffer for a final volume of 100 μl. The samples were boiled for 5 minutes. Out of the 100 μL boiled sample, 20 μL were loaded on an Invitrogen 4–12% Bis-Tris gel using MES running buffer (concentration of MBP substrate loaded is 2 μg per lane), and protein was transferred to nitrocellulose or PVDF and probed with anti-phospho-MBP following the instructions contained within the non-radioactive MAP Kinase/Erk assay kit’s (cat. #17-191) datasheet
Note: An equal amount was used in all Catch and Release® and conventional immunoprecipitation conditions (500 μg total cellular protein was used).
EZ-ChIP
Chromatin Immunopercipitation (ChIP)
Chromatin Immunoprecipitation (ChIP) is a widely used method to identify specific proteins associated with a region of the genome, or in reverse, to identify regions of the genome associated with specific proteins. These proteins can be isoforms of histones modified at a particular amino acid or other chromatin associated proteins. When employed with antibodies that recognize histone modifications, ChIP can be used to “measure” the amount of the modification. An example of this would include measurement of the amount of histone H3 acetylation associated with a specific gene promoter region under various conditions that might alter expression of the gene. Histones are not the only proteins that can be studied using this technique. Much of the recent interest has been in analyzing transcription factor distribution throughout the genome or at specific loci.
When performing ChIP, cells are first fixed with formaldehyde to crosslink proteins to DNA and then chromatin is harvested from the cells and subjected to an immunoselection process, which requires the use of specific antibodies. Any DNA sequences crosslinked to the protein of interest will co-precipitate as part of the chromatin complex. After the immunoselection of chromatin fragments and purification of associated DNA, the detection of specific DNA sequences is performed. If the DNA which will be detected is associated with the protein or histone modification being examined, the relative representation of that DNA sequence will be increased (or enriched) by the immunoprecipitation process.
Generally, standard PCR* is performed to identify the DNA sequence (the gene or region of the genome) associated with the protein of interest. The relative abundance of a specific DNA sequence isolated via the protein-specific immunoselection is compared to DNA obtained when using an unrelated antibody control. DNA fragments are run on gels to facilitate quantitation of the PCR products. A much more accurate alternative to standard PCR is real time quantitative PCR (qPCR). Cloning of sequences from a ChIP experiment is also possible, to create libraries of fragments that are enriched for those that interact with a particular protein. The combination of chromatin IP with microarray applications (ChIP on ChIP) is a novel technique that is becoming more popular, allowing the generation of genome-wide maps of protein DNA interactions or histone modifications.
EZ-ChIP Kit
The Millipore’s EZ-ChIP Kit (Cat.No. 17-371) contains the buffers and reagents required to perform a successful ChIP from mammalian cells. Importantly, EZ-ChIP also contains essential controls (anti-RNA Polymerase II, Normal Mouse IgG and Control Primers) to ensure that the user has successfully performed the ChIP assay. RNA Polymerase II is responsible for the ranscription of protein coding genes, and therefore, is present at the promoter region of genes that are actively transcribed. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene is considered a housekeeping gene and expected to be undergoing transcription in most growing mammalian cells. Upon immunoprecipitation (IP) of chromatin with an antibody to RNA Polymerase II, the resulting DNA is enriched for the GAPDH gene (as well as all transcribed genes), whereas IP with Normal Mouse IgG will not result in GAPDH enrichment. The covalent bonds between the DNA and associated proteins are then severed, and DNA is purified prior to performing PCR. For DNA purification, the EZ-ChIP kit incorporates a unique polypropylene Spin Column manufactured by MO BIO Laboratories, Inc. Each Spin Column contains a specially activated silica membrane filter that captures DNA and separates it from contaminating proteins and other cellular debris. After soluble contaminants are spun through the filter, the column is washed and then DNA is eluted in a low-salt buffer. Bind Buffer “A”, Wash Buffer “B” and Elute Buffer “C” are supplied by MO BIO Laboratories, Inc. and are Rnase and Dnase free. This technology from MO BIO Laboratories, Inc. provides rapid purification of chromatin DNA without the need for phenol chloroform extractions or ethanol precipitation. The purified DNA is subjected to PCR using the Control Primers which are specific to the promoter region of the GAPDH gene.
EZ-ChIP Advantages
- Easier: Spin Columns make DNA purification easier and more reliable – no more messy phenol-chloroform extractions
- Quicker: All reagents to process your samples are included — you don’t have to spend valuable time making them
- Greater Reproducibility: Positive and negative control antibodies and PCR primers included to help validate your results and troubleshoot experiments
ChIP Assay Overview
An overview of the assay is presented below, and the full protocol is provided in the following section.
A. Chromatin Sample Prep and Immunoselection
- Formaldehyde treatment of cells This treatment crosslinks the proteins to the DNA ensuring co-precipitation of the DNA with the protein of interest.
- Lysis and sonication of the cells Cells are broken open and sonication is performed to shear the chromatin to a manageable size. Generally, 200–1000 bp of DNA is small enough to achieve a high degree of resolution during the detection step. It is critical that average size be confirmed empirically by gel electrophoresis.
- Immunoselection This is very similar to a standard IP by using a primary antibody of choice followed by Protein G-conjugated agarose beads as the secondary reagent. This enriches for the protein of interest and the DNA that it is specifically complexed with.
B. DNA Purification and Detection
- Purification of the DNA Protein-DNA crosslinks are reversed during incubation at 65°C, and DNA is purified to remove the chromatin proteins and to prepare the DNA for the detection step.
- Detection This is the most variable step of the procedure because of the number of detection methods that can be employed as well as the variability inherent in PCR optimization and primer design. The most meaningful results will be obtained with quantitative PCR for this step. Real time qPCR is ideal, but this method requires a specialized PCR machine that may not be available. For standard PCR, primer selection is critical and must be designed with close adherence to the following guidelines:
- Primer Length: 24 nt
Optimum Tm: 60°C
Optimum GC: 50%
Amplicon size: 100–700 base pairs
After standard PCR, the PCR products are run on agarose or polyacrylamide gels, and the gels are stained and imaged as appropriate.
System Components
- Protein G Agarose/Salmon Sperm DNA, Catalog # 16–201C, Lot # 0606031838. One vial containing 1.5 mL packed beads with 600 μg sonicated salmon sperm DNA, 1.5 mg BSA and approximately 4.5 mg recombinant Protein G. Provided as a 50% gel slurry for a final volume of 3 mL per vial. Suspended in TE buffer, pH 8.0, containing 0.05% sodium azide. Liquid suspension. Store at 4°C.
- ChIP Dilution Buffer, Catalog # 20-153, Lot # 0607034802. One vial containing 24 mL of 0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, 167 mM NaCl. Store at 4°C.
- Low Salt Immune Complex Wash Buffer, Catalog # 20–154, Lot # 0605031372. One vial containing 24 mL of 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl. Store at 4°C.
- High Salt Immune Complex Wash Buffer, Catalog # 20–155, Lot # 0609040615. One vial containing 24 mL of 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 500 mM NaCl. Store at 4°C.
- LiCl Immune Complex Wash Buffer, Catalog # 20–156, Lot # 0607034805. One vial containing 24 mL of 0.25M LiCl, 1% IGEPALCA630, 1% deoxycholic acid (sodium salt), 1 mM EDTA, 10 mM Tris, pH 8.1. Store at 4°C.
- TE Buffer, Catalog # 20–157, Lot # 0607034806. Two vials, each containing 24 mL of 10 mM Tris- Hcl, 1 mM EDTA, pH 8.0. Store at 4°C.
- 5 M NaCl, Catalog # 20–159, Lot # 0609040598. One vial containing 500 μL of 5 M NaCl. Store at 4°C
- SDS Lysis Buffer, Catalog # 20–163, Lot # A607034808. One vial containing 10 mL of 1% SDS, 10 mM EDTA, 50 mM Tris, pH 8.1. Store at 4°C.
- 1M Tris-HCl, pH 6.5, Catalog # 20–160, Lot # 0607034807. One vial containing 500 μL of 1M Tris-HCl, pH 6.5. Store at 4°C.
- 10X Glycine, Catalog # 20–282, Lot # 0609040599. One vial containing 11 mL of 1.25 M Glycine. Store at 4°C.
- Protease Inhibitor Cocktail II, Catalog # 20–283, Lot # 0608038483 Two vials, each containing 110 μL of 200X Protease Inhibitor Cocktail II in DMSO. Store at –20°C.
- Rnase A, Catalog # 20–297, Lot # 0605030936. One vial containing 600 μg of Rnase A in 60 μL of sterile water. Store at –20°C.
- Proteinase K, Catalog # 20–298, Lot # 0605030940. One vial containing 600 μg of Proteinase K in 60 μL of 50 mM Tris-HCl, pH 8.0, 10 mM CaCl2. Store at –20°C.
- 1 M NaHCO3, Catalog # 20–296, Lot # 0609040083. One vial containing 600 μL of 1 M NaHCO3. Store at –20°C.
- 10X PCR Buffer, Catalog # 20–295, Lot # 0605030937. One vial containing 200 Ll of 750 mM Tris-HCl, pH 8.8, 200 mM (NH4)2SO4, 0. 1% Tween®-20, 25 mM MgCl2. Store at –20°C.
- Control Primers, Catalog # 22–004, Lot # 0605030943. One vial containing 75 μL of 5 μM of each control primer specific for human GAPDH. Store at –20°C.
- FOR: 5’-TACTAGCGGTTTTACGGGCG–3’
- REV: 5’-TCGAACAGGAGGAGCAGAGAGGA–3’
- Anti-RNA Polymerase II, clone CTD4H8, Catalog # 05-623B, Lot # 0610044102. One vial containing 25 μg of Anti-RNA Polymerase II, clone CTD448. Store at –20°C.
- Normal Mouse IgG, Catalog # 12–371B, Lot # 0605030935. One vial containing 25 μg of normal mouse IgG. Store at –20°C.
- 20% SDS, Catalog # 20–280, Lot # 0609040081 One vial containing 242 μL of 20% SDS. Store at Room Temperature.
- Spin Filters, Catalog # 20–290, Lot # 40000. One bag containing 22 Spin Filters in Collection Tubes. Store at Room Temperature.
- Collection Tubes, Catalog # 20–291, Lot # 40000. One bag containing 22 Collection Tubes. Store at Room Temperature.
- Bind Reagent A, Catalog # 20–292, Lot # 40000. One vial containing 25 mL of Bind Reagent A. Store at Room Temperature.
- Wash Reagent B, Catalog # 20–293, Lot # 40000. One vial containing 12.5 mL of Wash Reagent B. Store at Room Temperature.
- Elution Reagent C, Catalog # 20–294, Lot # 40000. One vial containing 1.5 mL of Elution Reagent C. Store at Room Temperature.
Chromatin Immunoprecipitation Protocol
A. In Vivo Crosslinking and Lysis
Setup
Prior to starting this section:
- Stimulate or treat, if necessary, adherent mammalian cells at ~80–90% confluency in a 100 mm culture dish containing 10 mL of growth media
- For HeLa cells, this is approximately 2 x 107 cells. This will generate a preparation of chromatin that can be used for up to 10 separate Ips.
- Include one extra dish to be used solely for estimation of cell number.
- Obtain ice for incubation of PBS (see step 3) and for incubating culture dish (see step 6).
- Prepare 21 mL of 1X PBS (2.1 mL 10X PBS and 18. 9 mL water) for each 100 mm culture dish and put on ice. This will be used for washes and needs to be ice cold.
- Warm SDS Lysis Buffer to room temperature to ensure SDS is in solution before proceeding with cell lysis.
- Remove Protease Inhibitor Cocktail II and thaw at room temperature for use in steps 3 and 13. This product contains DMSO and will remain frozen below 18.4°C.
Procedure
- Add 270 μL of 37% formaldehyde (or 540 μL of fresh 18.5% formaldehyde) to 10 mL of growth media to crosslink and gently swirl dish to mix.
- Final concentration is 1%.
- Use high quality formaldehyde. Do not use if formaldehyde is past the expiration date as suggested by the manufacturer. To make fresh formaldehyde before each experiment, see “Preparation of Fresh Formaldehyde” in the Appendix.
- Incubate at room temperature for 10 minutes.
- Agitation of cells is not necessary.
- Meanwhile, remove 1 mL of ice cold 1X PBS to a separate tube for every dish, and add 5 μL of Protease Inhibitor Cocktail II to each 1 mL of 1X PBS and put on ice.
- Add 1 mL of 10X Glycine to each dish to quench unreacted formaldehyde.
- Swirl to mix, and incubate at room temperature for 5 minutes.
- Place dish on ice.
- Aspirate medium, removing as much medium as possible, being careful not to disturb the cells.
- Add 10 mL of cold 1X PBS to wash cells.
- Remove PBS and repeat PBS washes, steps 8 and 9.
- Add 1 mL cold PBS containing 1X Protease Inhibitor Cocktail II to dish (made in step 3).
- Scrape cells from each dish into a microfuge tube.
- Spin at 700 x g at 4°C for 2-5 minutes to pellet cells.
- During spin, add 5 μL of Protease Inhibitor Cocktail II to each 1 mL of SDS Lysis Buffer required.
- For every 2 x 107 HeLa cells, 1 mL of SDS Lysis Buffer is recommended for this protocol. Adjust accordingly if different cell concentrations are desired as the ratio of lysis buffer to cell density is important for reliable cell lysis.
- Remove supernatant. (Cell pellet can be frozen at –80°C at this step.)
- Resuspend cell pellet in 1 mL of SDS Lysis Buffer containing 1X Protease Inhibitor Cocktail II.
- Aliquot between 300–400 μL per microfuge tube. (Lysate can be frozen at -80°C at this step.)
- If optimal conditions for sonication have already been determined, proceed to Section B. Other wise, see “Optimization of DNA Sonication” in the Appendix.
B. Sonication to Shear DNA
Setup
Prior to starting this section:
- Optimal conditions required for shearing crosslinked DNA to ~200–1000 base pairs in length need to be determined. See “Optimization of DNA Sonication” in the Appendix. for a protocol. Once optimal shearing conditions have been determined, proceed with the steps below.
Procedure
- If desired, remove 5 μL of cell lysate from Section A, step 17 for agarose gel analysis of unsheared DNA.
- If cell lysate from Section A, step 17 was previously frozen, thaw on ice.
- Sonicate cell lysate on wet ice.
- HeLa cells in SDS Lysis Buffer at a cell concentration of 2 x 107 per mL sheared with 4–5 sets of 10 second pulses on wet ice using a Cole Parmer, High Intensity Ultrasonic Processor/Sonicator, 50 watt model equipped with a 2 mm tip and set to 30% of maximum power gave the appropriate length DNA fragments. See the “DNA Sonication” figure below.
- Keep cell lysate ice-cold. Sonication produces heat, which can denature the chromatin.
- Spin at a minimum of 10,000 x g, but not exceeding 15,000 x g at 4°C for 10 minutes to remove insoluble material.
- If desired, remove one 5 μL aliquot for agarose gel analysis of the sheared DNA.
- To prepare an aliquot for agarose gel analysis, join the “Optimization of DNA Sonication” protocol in the Appendix at step 7.
- Remove supernatant to fresh microfuge tubes in 100 μL aliquots.
- Each 100 μL aliquot contains 2 x 106 cell equivalents of lysate which is enough for one IP.
- Sheared crosslinked chromatin can be stored at -80°C for up to a few months.
C. Immunoprecipitation (IP) of Crosslinked Protein/DNA
Setup
Prior to starting this section:
- Remove Protease Inhibitor Cocktail II and thaw at room temperature for use in step 3. This product contains DMSO and will remain frozen below 18.4°C.
Procedure
- Prepare enough Dilution Buffer containing protease inhibitors for the number of desired IP and store on ice.
- Each IP requires the addition of 900 μL of Dilution Buffer and 4.5 μL of Protease Inhibitor Cocktail II.
- Samples include the positive control, Anti- RNA Polymerase II, and the negative control, Normal Mouse IgG, and the antibody of interest (user supplied). It is recommended that the user include a negative control IgG of the same species as the antibody of interest.
- Prepare one microfuge tube containing 100 μL of sheared crosslinked chromatin (Section B, step 5) for the number of desired Immunoprecipitations and put on ice. If chromatin has been previously frozen, thaw on ice.
- Alternatively, if multiple Immunoprecipitations will be performed from the same chromatin preparation, place the entire volume for the number of desired Ips in one large tube that will be able to accommodate a volume of 1.1 mL for each IP
- Each 100 μL will contain ~2 x 106 cell equivalents of chromatin.
- Add 900 μL of Dilution Buffer containing Protease Inhibitor Cocktail II into each tube containing 100 μL of chromatin.
- Alternatively, if multiple Immunoprecipitations will be performed from the same chromatin preparation, use the appropriate volume of Dilution Buffer containing Protease Inhibitor Cocktail II for the correct number of Immunoprecipitation
- Add 60 μL of Protein G Agarose for each IP.
- The Protein G Agarose is 50% slurry. Gently mix by inversion before removing.
- This step serves to “preclear” the chromatin, i.e., to remove proteins or DNA that may bind nonspecifically to the Protein G agarose.
- Alternatively, if multiple immunoprecipitations will be performed from the same chromatin preparation, use the appropriate volume of Protein G Agarose for the correct number of immunoprecipitations.
- Incubate for 1 hour at 4°C with rotation.
- Pellet agarose by brief centrifugation (3000–5000 xg for 1 minute).
- Do not spin Protein G Agarose beads at high speeds. Applying excessive g-force may crush or deform the beads and cause them to pellet inconsistently.
- Remove 10 μL (1%) of the supernatant as Input and save at 4°C until Section D, step 1.0 If different chromatin preparations are being carried together through this protocol, remove 1% of the chromatin as Input from each.
- Collect the supernatant by aliquoting 1 mL into fresh microfuge tubes.
- Add the immunoprecipitating antibody to the supernatant fraction:
- For the positive control, anti-RNA Polymerase, add 1.0 μg of antibody per tube.
- For the negative control, Normal Mouse IgG, add 1.0 μg of antibody per tube.
- For user-provided antibody and controls, add between 1-10 μg of antibody per tube. The appropriate amount of antibody needs to be empirically determined.
- Incubate overnight at 4°C with rotation.
- It may be possible to reduce the incubation time of the IP. This depends on many factors (antibody, gene target, cell type, etc.) and will have to be tested empirically.
- Add 60 μL of Protein G Agarose for 1 hour at 4°C with rotation.
- This serves to collect the antibody/ antigen/DNA complex.
- Pellet Protein G Agarose by brief centrifugation (3000–5000 x g for 1 minute) and remove the supernatant fraction.
- Wash the Protein G Agarose-antibody/ chromatin complex by resuspending the beads in 1 mL each of the cold buffers in the order listed on page 25 and incubating for 3–5 minutes on a rotating platform followed by brief centrifugation 3000–5000 x g for 1 minute) and careful removal of the supernatant fraction:
- Low Salt Immune Complex Wash Buffer (Cat. No. 20–154), one wash
- High Salt Immune Complex Wash Buffer (Cat. No. 20–155), one wash
- LiCl Immune Complex Wash Buffer (Cat. No. 20–156), one wash
- TE Buffer (Cat. No. 20–157), two washes
D. Elution of Protein/DNA Complexes
Prior to starting this section:
- Bring 1M NaHCO3 to room temperature. A precipitate may be observed but will go into solution once room temperature is achieved. The 1 M NaHCO3 can be vortexed.
- Set water bath to 65°C for use in Section E.
- Make Elution Buffer for all IP tubes, as well as all Input tubes (see Section C, step 7).
- For each tube, prepare 200 μL of elution buffer as follows: 10 μL 20% SDS, 20 μL 1 M NaHCO3 and 170 μL sterile, distilled water.
- Alternatively, make a large volume to accommodate all tubes. For example, if there are 10 tubes, mix together 105 μL 20% SDS, 210 μL 1 M NaHCO3 and 1.785 mL sterile, distilled water.
- For Input tubes (see Section C, step 7), add 200 μL of Elution Buffer and set aside at room temperature until Section E.
- Add 100 μL of Elution Buffer to each tube containing the antibody/agarose complex. Mix by flicking tube gently.
- Incubate at room temperature for 15 minutes.
- Pellet agarose by brief centrifugation (3000–5000 xg for 1 minute) and collect supernatant into new microfuge tubes.
- Repeat steps 4–6 and combine eluates (total volume = 200 μL).
E. Reverse Crosslinks of Protein/DNA Complexes to Free DNA
- To all tubes (IPs and Inputs), add 8 μL 5 M NaCl and incubate at 65°C for 4–5 hours or overnight to reverse the DNA–Protein crosslinks. After this step, the sample can be stored at –20°C and the protocol continued the next day.
- To all tubes, add 1 μL of Rnase A and incubate for 30 minutes at 37°C.
- Add 4 μL 0.5 M EDTA, 8 μL 1 M Tris-HCl and 1 μL Proteinase K and incubate at 45°C for 1–2 hours.
F. DNA Purification Using Spin Columns
- Remove one Spin Filter in Collection Tube and one separate Collection Tube for each sample tube from Section E.
- Add 1 mL of Bind Reagent “A” to each 200 μL DNA sample tube (IPs and Inputs) and mix well.
- 5 volumes of Bind Reagent “A” should be used for every 1 volume of sample.
- A precipitate may be observed in the bottom of the Collection Tube. This will not interfere with the procedure.
- Transfer 600 μL of sample/Bind Reagent “A” mixture to the Spin Filter in Collection Tube.
- Centrifuge for 30 seconds at a minimum of 10,000 xg, but not exceeding 15,000 xg.
- Remove the Spin Filter from the Collection Tube, save the Collection Tube and discard the liquid.
- Put the Spin Filter back into the same Collection Tube.
- Transfer the remaining 600 μL of sample/Bind Reagent “A” mixture from step 2 into the Spin Filter and repeat steps 4–6.
- Add 500 μL of the Wash Reagent “B” to the Spin Filter in Collection Tube.
- Centrifuge for 30 seconds at a minimum of 10,000 xg, but not exceeding 15,000 xg.
- Remove the Spin Filter from the Collection Tube, save the Collection Tube and discard the liquid.
- Put the Spin Filter back into the same Tube.
- Centrifuge for 30 seconds at a minimum of 10,000 xg, but not exceeding 15,000 xg.
- Discard the Collection Tube and liquid.
- Put the Spin Filter into a clean Collection Tube.
- Add 50 μL of Elution Buffer “C” directly onto the center of the white Spin Filter membrane.
- Centrifuge for 30 seconds at a minimum of 10,000 xg, but not exceeding 15,000 xg.
- Remove and discard Spin Filter. Eluate is now purified DNA. It can be analyzed immediately or stored frozen at –20°C
G. PCR of Controls
Note: Filter-tip pipette tips are recommended for use in this section to minimize risk of contamination. Also, you may choose to use the PCR buffer supplied by the manufacturer of the thermostable polymerase being used.
- Label the appropriate number of 0.2 mL PCR tubes for the number of samples to be analyzed and place on ice
- At a minimum, there will be 4 DNA samples to undergo PCR using the Control Primers included in this kit: positive and negative control antibody immunoprecipitations, Input and a no DNA tube as a control for DNA contamination.
- The Control Primers are specific for the human GAPDH gene. It is recommended that the user design appropriate specific primers for DNA from other species and determine the PCR reaction conditions empirically.
- Add 2 μL of the appropriate sample to the tube and return to ice.
- Add the appropriate amount of reagents to each CR reaction tube on ice, adding the H2O first and the Taq polymerase last, as indicated in the table.
- It is recommended that the user employ a Hot-Start Taq polymerase. If user is not employing a Hot-Start Taq polymerase, Taq must be added to each tube after the initial denaturation step.
- If a master reaction mix is desired, dispense enough reagent for one extra tube to account for loss of volume.
PCR Reagent Volumes
| Reagent | Volume for 1 reaction (μ) |
| DNA | 2.0 |
| H2O | 13.2 |
| 10x PCR Buffer | 2.0 |
| 2.5mM dNTP | 1.6 |
| Control Primers | 0.8 |
| Tag (5U/μL) | 0.4 |
- Place the PCR reaction tubes in a thermal cycler.
- Start the following PCR reaction program:
| Initial Denaturation | 94 °C | 3 Minutes |
| Denature | 94 °C | 20 seconds |
| Anneal | 59 °C | 30 seconds |
| Extension | 72 °C | 30 seconds |
| Final Extension | 72 °C | 2 minutes |
- Remove the PCR tubes. Reactions can be stored at –20°C.
- Remove 10 μL of each PCR reaction for analysis by 4% agarose gel electrophoresis with a 100 bp DNA marker. The expected size of the PCR product is 166 base pairs. See the figure “PCR Analysis of Chromatin Immunoprecipitation” below for an example.
CHROMATIN IMMUNOPRECIPITATION (ChIP) Assay: Technical Note
Quantitation of DNA
DNA purified from ChIP experiments can be quantitated by PCR, providing the amplifying oligos meet specific criteria. Oligos should be 24 mers, with a GC content of 50% (+/– 4 ) and a Tm of 60.0°C (+/ 2.0). You must be certain that the PCR reactions are within the linear range of amplification.
Generally it takes some optimization to achieve this as too much input DNA will affect PCR. It is recommended to set up several tubes for each experiment to optimize the input DNA. Generally, this is about 1/25th to 1/100th for yeast, approx. 1/10 for mammalian cells, however depends on the amount of antibody and input chromatin. Also, do not use more than 20 PCR cycles, making sure that dNTPs always remain in excess. It is recommended to include in each PCR reaction, a control primer (to compare your experimental band against--make sure the sizes are sufficiently different to allow proper separation--75 base pairs is usually OK) set to a region of the genome that should not be change throughout your experimental conditions. The PCR control can be used from purified input DNA (no ChIP) and include a no antibody control PCRs as well. Keep amplified fragments between 250 and 750 base pairs.
All PCR products should be run on 7–8% acrylamide gels and stained with SYBR Green I (Molecular Probes) at a dilution of 1:10,000 (in 1X Tris-borate-EDTA buffer, pH 7.5) for 30 minutes-no destaining is required. Quantitation is carried out subsequent to scanning of the gel on a Molecular Dynamics Storm® 840 or 860 in Blue fluoresence mode with PMT voltage at 900 with ImageQuant® software. This has distinct advantages over ethidium bromide staining. SYBR Green is much more sensitive, and illumination of ethidium stained gels can vary across the gel based on the quality of UV bulbs in your light box. For further references, see Strahl-Bolsinger et al. (1997) Genes Dev. 11: 83–93. For radioactive quantitation method, see as described in Suka, et al (2001) Molecular. Cell. 8:473–479.
PCR Conditions
For further elaboration and information on all chromatin assay protocols, please consult “Chromatin Protocols,” edited by Peter B. Becker, Methods in Molecular Biology, volume 119, Humana Press, 1999 (ISBN 0–89603–665-0). The following are conditions that have been successfully used at Millipore:
PCR conditions for the Fos promoter in 3T3 cells First round PCR
- GGCGAGCTGGTTCCCGTCAATCC–5’ primer
- TGCAGTCGCGGTTGGAGTAGTAGG–3’ primer
- 5 microliters DNA sample from post 65C reverse cross-linking
- 2 microliters input DNA collected at step #6
- No DNA control
- Buffer conditions: 2.5 units Taq DNA Polymerase (add last), 10mM Tris Hcl, 50mM Kcl, 1.5mM MgCl2, 200uM dNTP’s, 1.0uM forward and reverse primers, mix in final volume of 100 microliters:
Thermocycler setting:
Step 1. | 94C for 3 min |
Step 2. | 94C for 1 min. |
Step 3. | 57C for 2 min. |
Step 4. | 72C for 3 min. |
Step 5. | repeat steps 2-4, 19 times |
Step 6. | 72C for 5 min. |
Step 7. | 0C-4C indefinitely |
Second round PCR:
- TCCACGGCCGGTCCCTGTTGTTCT–5’ primer
- GCGGGCGCTCTGTCGTcAACTCTA–3’ primer
- 2 microliters from first round
- Buffer conditions: 2.5 units Taq DNA Polymerase (add last), 10mM Tris Hcl, 50mM Kcl, 1.5mM MgCl2, 200uM dNTP’s, 1.0uM forward and reverse primers, mix in final volume of 100 microliters.
Thermocycler setting:
Step 1. | 94C for 3 min |
Step 2. | 94C for 1 min. |
Step 3. | 57C for 2 min. |
Step 4. | 72C for 3 min. |
Step 5. | repeat steps 2-4, 19 times |
Step 6. | 72C for 5 min. |
Step 7. | 0C-4C indefinitely |
Run 2nd round PCR product on a 1.4% agarose gel. 30 microliters of product + 3 microliters of dye.
DNA Sonication Unsheared and sheared chromatin from formaldehyde-crosslinked HeLa cells was prepared by following Section A (all steps), Section B (steps 1–4) and “Optimization of DNA Sonication” in the Appendix (steps 7-9) of the EZ-ChIP protocol. 20 μL of unsheared (lane 1) and sheared (lane 2) chromatin was then electrophoresed through a 2% agarose gel and stained with ethidium bromide. Lane 2 shows that the majority of the DNA has been sheared to a length between 200 bp and 1000 bp. |
PCR Analysis of ChIP ChIP was performed using chromatin from HeLa cells and either anti-RNA Polymerase II (Cat. No. 05–623) or Normal Mouse IgG (Cat. No. 12–371) as the immunoprecipitating antibody. Purified DNA was then analyzed by PCR using Control Primers specific for the GAPDH promoter. PCR product was obser ved in the anti-RNA Polymerase II ChIP (lane 3) but not in the Normal Mouse IgG ChIP (lane 2). GAPDH promoter specific DNA was also observed in the Input (lane 4) but not in the “No DNA” PCR control (lane 1). |
Product News & Releases
- New Product Guide to Millipore’s Antibodies and Kits - Free reference book for immunoassay and protein research application
- New OxyELISA™ Kit Provides Quantitative Measure of Oxidative Stress - High throughput kit improves specificity and shortens assay time
- PureProteome™ Nickel Magnetic Beads from Millipore
- Millipore Launches SNAP i.d.™ Protein Detection System
Featured Products
- Catch and Release Reversible Immunoprecipitation system
- Protein G Agarose Fast Flow
- Immobilon-FL Transfer Membrane
- Immobilon Chemiluminescent HRP Substrate
- Amicon Ultra
- Ultrafree MC
- Anti-NeuN, Marker for Post-Mitotic Neurons
- Anti-Tyrosine Hydroxylase
- Anti-Actin (Clone C4)
- Anti-Cytokeratin 5, 6, Clone D5/16B4

